Review



pcmv vectors expressing myc s1p  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    ATCC pcmv vectors expressing myc s1p
    Pcmv Vectors Expressing Myc S1p, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcmv+vectors+expressing+myc+s1p/pCMV-Myc-S1P/pm31914686-49-12-22
    Average 90 stars, based on 3 article reviews
    pcmv vectors expressing myc s1p - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: Production of BBF2H7‐derived small peptide fragments via endoplasmic reticulum stress‐dependent regulated intramembrane proteolysis
    Article Snippet: Apelin-36 was purchased from Cayman chemical Company (Ann Arbor, MI, USA). .. The pcDNA3.1(+) vectors expressing BBF2H7, BBF2H7S1Pmut. (R427A/L430V), and FLAG-BBF2H7 were previously constructed.19 pCMV vectors expressing Myc-S1P and HSV-S2P were purchased from the American Type Culture Collection (ATCC). pcDNA3.1(+) vector expressing HA-S2P was generated by PCR using the following primer sets: 5′-GCGGCCGCCACCATG TACCCATACGATGTTCCAGATTACGCTATGATT CCGGTGTCGCTG-3′ (HA-S2P forward) and 5′-CTCG AGTTACCGTGCTGTAACCATC-3′ (reverse). .. The transfections of expression vectors were performed using ScreenFectA (Wako) according to the manufacturer's protocol.

    Construct:

    Article Title: Production of BBF2H7‐derived small peptide fragments via endoplasmic reticulum stress‐dependent regulated intramembrane proteolysis
    Article Snippet: Apelin-36 was purchased from Cayman chemical Company (Ann Arbor, MI, USA). .. The pcDNA3.1(+) vectors expressing BBF2H7, BBF2H7S1Pmut. (R427A/L430V), and FLAG-BBF2H7 were previously constructed.19 pCMV vectors expressing Myc-S1P and HSV-S2P were purchased from the American Type Culture Collection (ATCC). pcDNA3.1(+) vector expressing HA-S2P was generated by PCR using the following primer sets: 5′-GCGGCCGCCACCATG TACCCATACGATGTTCCAGATTACGCTATGATT CCGGTGTCGCTG-3′ (HA-S2P forward) and 5′-CTCG AGTTACCGTGCTGTAACCATC-3′ (reverse). .. The transfections of expression vectors were performed using ScreenFectA (Wako) according to the manufacturer's protocol.

    Generated:

    Article Title: Production of BBF2H7‐derived small peptide fragments via endoplasmic reticulum stress‐dependent regulated intramembrane proteolysis
    Article Snippet: Apelin-36 was purchased from Cayman chemical Company (Ann Arbor, MI, USA). .. The pcDNA3.1(+) vectors expressing BBF2H7, BBF2H7S1Pmut. (R427A/L430V), and FLAG-BBF2H7 were previously constructed.19 pCMV vectors expressing Myc-S1P and HSV-S2P were purchased from the American Type Culture Collection (ATCC). pcDNA3.1(+) vector expressing HA-S2P was generated by PCR using the following primer sets: 5′-GCGGCCGCCACCATG TACCCATACGATGTTCCAGATTACGCTATGATT CCGGTGTCGCTG-3′ (HA-S2P forward) and 5′-CTCG AGTTACCGTGCTGTAACCATC-3′ (reverse). .. The transfections of expression vectors were performed using ScreenFectA (Wako) according to the manufacturer's protocol.

    Polymerase Chain Reaction:

    Article Title: Production of BBF2H7‐derived small peptide fragments via endoplasmic reticulum stress‐dependent regulated intramembrane proteolysis
    Article Snippet: Apelin-36 was purchased from Cayman chemical Company (Ann Arbor, MI, USA). .. The pcDNA3.1(+) vectors expressing BBF2H7, BBF2H7S1Pmut. (R427A/L430V), and FLAG-BBF2H7 were previously constructed.19 pCMV vectors expressing Myc-S1P and HSV-S2P were purchased from the American Type Culture Collection (ATCC). pcDNA3.1(+) vector expressing HA-S2P was generated by PCR using the following primer sets: 5′-GCGGCCGCCACCATG TACCCATACGATGTTCCAGATTACGCTATGATT CCGGTGTCGCTG-3′ (HA-S2P forward) and 5′-CTCG AGTTACCGTGCTGTAACCATC-3′ (reverse). .. The transfections of expression vectors were performed using ScreenFectA (Wako) according to the manufacturer's protocol.



    Similar Products

    pcmv vectors expressing myc s1p  (ATCC)
    90
    ATCC pcmv vectors expressing myc s1p
    Pcmv Vectors Expressing Myc S1p, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcmv+vectors+expressing+myc+s1p/pCMV-Myc-S1P/pm31914686-49-12-22
    Average 90 stars, based on 1 article reviews
    pcmv vectors expressing myc s1p - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results